|
Thermo Fisher
rabbit polyclonals against zo2 Rabbit Polyclonals Against Zo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonals against zo2/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit polyclonals against zo2 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
polyclonal rabbit anti zo 2 antibody no 71 1400 ![]() Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher Average 86 stars, based on 1 article reviews
polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti–zo-2 pab ![]() Rabbit Anti–Zo 2 Pab, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti–zo-2 pab/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit anti–zo-2 pab - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Novus Biologicals
antibodies against zo-2 ![]() Antibodies Against Zo 2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies against zo-2/product/Novus Biologicals Average 90 stars, based on 1 article reviews
antibodies against zo-2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
polyclonal antibody zo 2 2847 cell signaling technology ![]() Polyclonal Antibody Zo 2 2847 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal antibody zo 2 2847 cell signaling technology/product/Cell Signaling Technology Inc Average 95 stars, based on 1 article reviews
polyclonal antibody zo 2 2847 cell signaling technology - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
zo-2 ![]() Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
zo-2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit antibody against zo-2 ![]() Rabbit Antibody Against Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit antibody against zo-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit antibody against zo-2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit polyclonal anti-zo-2 (h-110) antibody ![]() Rabbit Polyclonal Anti Zo 2 (H 110) Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti-zo-2 (h-110) antibody/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-zo-2 (h-110) antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit polyclonal anti-zo-2: pa5-17155 ![]() Rabbit Polyclonal Anti Zo 2: Pa5 17155, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti-zo-2: pa5-17155/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-zo-2: pa5-17155 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
zo 2 ![]() Zo 2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo 2/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
zo 2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit polyclonals against zo-2 711400 antibody ![]() Rabbit Polyclonals Against Zo 2 711400 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonals against zo-2 711400 antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit polyclonals against zo-2 711400 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit anti-zo-2 pab h-110 ![]() Rabbit Anti Zo 2 Pab H 110, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti-zo-2 pab h-110/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
rabbit anti-zo-2 pab h-110 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies
Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C ,
Techniques: Sequencing
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 translocates to the cell borders on activation of the CaSR that through the Gα q/11 subunit stimulates PKCε that in turn activates WNK proteins and adenylyl cyclase/AMPK. Monolayers were plated at confluent density and incubated in NC media for 24 h (SS) or for 1 h in NC media and then were transferred to LC for 20 h after which they were treated as indicated in the scheme, with 100 μM Gd 3+ , an agonist of CaSR; 4 μM WNK463, an inhibitor of WNK proteins; 0.5 mM DiC8, an activator of conventional and novel PKCs; 200 nM bryostatin, an stimulator of nPKC δ and ε; 6 μM röttlerin an inhibitor of nPKCδ; 4 mM AICAR, a stimulator of AMPK; and 50 μM dorsomorphin, an inhibitor of AMPK. Left panels, immunofluorescence images done with an antibody against ZO-2. Nuclei were stained with DAPI. Bars, 20 μm. Images taken from at least two independent experiments. Middle panels, monolayer treatment scheme. Right panels, quantification of ZO-2 fluorescence staining at the cell borders. Statistical analysis was done with Student’s t test *** p < 0.001; **** p < 0.0001; ns, nonsignificant. Results obtained from six optical fields in each experimental condition. Data are from two independent experiments. All the quantitative results in this and the following figures correspond to mean ± SE.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Activation Assay, Incubation, Immunofluorescence, Staining, Fluorescence
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: PKC activation increases the phosphorylation of ZO-2 at serine residues in monolayers cultured in LC media. (A) Monolayers cultured in LC for 20 h were subjected to a CS for 2 h or maintained in LC and treated or not (vehicle only, DMSO 0.25%) for 2 h with 0.5 mM DiC8, or pretreated for 2 h with 4 μM WNK463 and then transferred to media with 4 μM WNK463 plus 0.5 mM DiC8. The PLA was done with a rabbit antibody against ZO-2 and a mouse antibody anti pSer. Background, PLA done in LC monolayers without both primary antibodies. Nuclei stained with DAPI. Bar, 30 μm. Top panel, representative images; middle left panel, schematic design of experiment; bottom left panel, quantitative analysis done using BlobFinder. Statistical analysis done with one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison test, ** p < 0.01; **** p < 0.0001. Results were obtained from six optical fields in each experimental condition. Results are from two independent experiments. (B) The amount of phosphorylated serines residues in ZO-2 increased after DiC8 treatment. Western blot of a ZO-2 immunoprecipitate from LC cultured cells, treated or not for 2 h with 0.5 mM DiC8, and blotted against phosphorylated serine residues. Top panel, representative image of three independent experiments; bottom panel, quantitative analysis. Statistical analysis done with Student t test, ** p < 0.01. PIS, preimune serum. (C) MDCK monolayers were transfected with HA-cZO-2, cultured in LC for 20 h and then were subjected to a CS for 2 h or were maintained in LC and treated or not for 2 h with 0.5 mM DiC8. PLA was done with a rabbit antibody against phosphorylated serines present in the PKC target motif R/KXSϕR/K and a mouse antibody anti HA. Cells transfected with HA-ZO-2 were identified with a mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488. Background corresponds to LC cultured cells not transfected with HA-cZO-2. Bars, 20 μm. Left panel, representative images; right panel, quantitative analysis done using BlobFinder. Statistical analysis done with one-way ANOVA followed by Dunnett’s multiple comparison test **** p < 0.0001. Results obtained with 100 transfected cells per condition derived from two independent experiments.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Activation Assay, Cell Culture, Staining, Western Blot, Transfection, Derivative Assay
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: PKCε activation increases the interaction of ZO-2 with WNK4 in monolayers cultured in LC media. (A) PLA assays done in monolayers cultured in LC or after a CS with a rabbit antibody against ZO-2 and a mouse antibody anti-HA. Monolayers were treated or not for 2 h with 0.5 mM DiC8 or 200 nM bryostatin. In addition, as indicated, some monolayers were pretreated for 30 min and thereafter for 2 h with 25 nM Ro-318220, or 2 μM of the PKCε inhibitor permeable peptide εv1-2. Cells transfected with WNK4-HA were identified with a mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488. Background corresponds to LC cultured cells not transfected with WNK4-HA. Bars, 25 μm. Top panel, representative images; bottom panel, quantitative analysis done using BlobFinder. Statistical analysis was done with Kruskal-Wallis test followed by Dunn’s multiple comparison test, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001; ns, nonsignificant. Results obtained from 30 transfected cells per condition derived from two independent experiments. (B) Treatment with DiC8 or bryostatin augments the amount of WNK4 that coimmunoprecipitates with ZO-2. ZO-2 was immunoprecipitated from LC cultured cells transfected with a WNK4-HA construct and treated or not for 2 h with 0.5 mM DiC8 or 200 nM bryostatin. After the SDS–PAGE the resulting membranes were blotted against HA and ZO-2. Results are from three independent experiments. Statistical analysis done with one-way ANOVA followed by Dunnett’s multiple comparison test, ** p < 0.01.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Activation Assay, Cell Culture, Transfection, Derivative Assay, Immunoprecipitation, Construct, SDS Page
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 is sequestered in the cytoplasm by 14-3-3 in the LC condition. (A) cZO-2 and hZO-2 sequences, respectively, have 25 and 22 putative 14-3-3 binding sites, 11 (cZO-2) and 10 (hZO-2) of which are located at the U2 segment. Scheme showing the molecular organization of ZO-2. PDZ, PDZ domain; SH3, Src homologous 3 domain; GK, guanylate kinase domain; Acidic, acidic region; PR, proline-rich segment; ABR, actin binding region; U, unique region; TEL, PDZ binding motif; NLS, nuclear localization signal; NES, nuclear exportation signal; vertical lines, putative 14-3-3 binding sites; blue letters and numbers, putative 14-3-3 binding sites located within an SR motif. (B) The inhibition of 14-3-3 with BV02 induces the appearance of ZO-1 and ZO-2 at the cell borders of cells cultured in LC. MDCK cells were plated at confluent density in NC media and after 1 h were washed 5× with PBS without Ca 2+ and transferred to LC media with 50 μM BV02 or vehicle only (DMSO 0.25%, control). After 20 h the monolayers were fixed and processed for immunofluorescence with antibodies against ZO-1, ZO-2, claudin-1, occludin, and cingulin. Top panel, representative images from three independent experiments. Nuclei were stained in blue with DAPI. Bar, 25 μm. Bottom panel, quantification of ZO-1 and ZO-2 fluorescence staining at the cell borders. Statistical analysis done with Student’s t test, **** p < 0.0001. Results obtained from six optical fields in each experimental condition. (C) The cellular content of ZO-2 diminishes in the LC condition after the inhibition of 14-3-3 with BV02, due to protein degradation in the proteosome. Cell lysates were obtained from monolayers cultured in the LC condition for 18 h in the presence or absence of 50 μM BV02 and then were incubated or not for 2 h with 30 μM MG132. Top panel, representative Western blot; bottom panel, densitometric analysis. Statistical analysis done with one-way ANOVA followed by Dunnett’s multiple comparison test, ** p < 0.05; *** p < 0.01. Results were obtained from three independent experiments. (D) Inhibition of 14-3-3 with BV02 promotes ubiquitination of ZO-2. MDCK cells cultured in LC condition for 20 h were transfected with a HA-ubiquitin construct. After 6 h, the monolayers were incubated with 50 μM BV02 for 20 h. In some monolayers, 30 μM of MG132 was also present in the last 2 h of incubation. ZO-2 was immunoprecipitated with a specific antibody and the blot was done with an antibody against HA. Top left panel, densitometric analysis. Statistical analysis was done with one-way ANOVA followed by Bonferroni’s multiple comparison test, * p < 0.005; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Results were obtained from three independent experiments. Bottom right panel, representative Western blot. (E) The amount of ZO-2 in the plasma membrane of cells cultured in LC decreases after 14-3-3 inhibition. Western blot of nuclear, membrane, and cytoplasm fractions derived from LC cultured cells treated for 20 h with 50 μM BV02. Antibodies against lamin B1, Na + ,K + -ATPase β1 subunit, and GAPDH were employed as markers of nuclear, plasma membrane, and cytoplasmic fractions, respectively. Numbers below the bands correspond to densitometric values reported as a ratio of ZO-2/lamin B1 in the nuclear fraction; ZO-2/Na + , K + , ATPase in the membrane fraction; and ZO-2/ GAPDH in the cytoplasm fraction of this representative experiment of a set of two independent experiments.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Binding Assay, Inhibition, Cell Culture, Immunofluorescence, Staining, Fluorescence, Incubation, Western Blot, Transfection, Construct, Immunoprecipitation, Derivative Assay
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 interacts in the cytoplasm with 14-3-3 in monolayers cultured in LC and this interaction diminishes with the CS. (A) The amount of 14-3-3 that coimmunoprecipitates with ZO-2 diminished after the CS. ZO-2 was immunoprecipitated from monolayers cultured in LC, and after a 4-h CS with a specific antibody, and the membranes were blotted with antibodies against ZO-2 and pan 14-3-3. PIS, preimmune serum. Left panel, representative image of three independent experiments; right panel, quantitative analysis. Statistical analysis was done with Student’s t test; * p < 0.05. (B) ZO-2 interaction with 14-3-3 in the cytoplasm of LC cultured cells diminishes with the CS. PLA was done in monolayers cultured in LC and after a 4-h CS with a rabbit antibody against ZO-2 and a mouse antibody anti pan 14-3-3. Nuclei were stained with DAPI. Background, experiment was done without primary antibodies. Bar, 50 μm. Left panel, representative images; right panel, quantitative analysis was done using BlobFinder. Statistical analysis was done with one-way ANOVA followed by Dunnett’s multiple comparison test, ** p < 0.01; *** p < 0.0001. Results were obtained from three independent experiments analyzing 60 cells per experimental condition. (C) Monolayers were cultured in LC and treated or not (vehicle only, DMSO 0.25%) for 2 h with 6 μM röttlerin. The PLA was done with a rabbit antibody against ZO-2 and a mouse antibody against pan14-3-3. Background, PLA was done in LC monolayers without both primary antibodies. Nuclei were stained with DAPI. Bar, 40 μm. Left panel, representative images; right panel, quantitative analysis done using BlobFinder. Statistical analysis was done with one-way ANOVA followed by Dunnett’s multiple comparison test; **** p < 0.0001. Results were derived from 11 optical fields analyzed per condition from two independent experiments.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Cell Culture, Immunoprecipitation, Staining, Derivative Assay
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 colocalization with 14-3-3σ in the cytoplasm of monolayers cultured in LC diminishes with the CS and is accompanied by a transient colocalization at the cell borders. (A) Immunofluorescence observation of ZO-2 and 14-3-3σ in monolayers cultured in the SS condition, LC condition for 20 h, or 2, 4, and 6 h after a CS. Left panel, representative images; right panel, cytoplasmic PCC. Statistical analysis done with Kruskal-Wallis test followed by Dunn’s multiple comparison test; **** p < 0.0001; ns, nonsignificant. Bars, 15 μm. (B) Fluorescence covariance i ndex (FCI = Log10 of PCC at cell periphery/PCC at cytoplasm) was done to compare the frequency of colocalization of 14-3-3σ with ZO-2 in the cell borders with the colocalization in the cytoplasm. SS, steady state condition. The values of FCI 2, 4, and 6 h after the CS are different from the SS condition since a small but significant proportion of cells exhibited FCI > 0 indicating that in them the colocalization of 14-3-3σ with ZO-2 was higher at the cell borders than at the cytoplasm. Statistical analysis done with one-way ANOVA followed by Dunnett’s multiple comparison test, SS ≠ CS (2 h) **** p < 0.0001; SS ≠ CS (4 h) **** p < 0.0001; SS ≠ CS (6 h).
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Cell Culture, Immunofluorescence, Fluorescence
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 colocalization with 14-3-3ζ in the cytoplasm of monolayers cultured in LC diminishes with the CS and is accompanied by a transient colocalization at the cell borders. (A) Immunofluorescence observation of ZO-2 and 14-3-3ζ in monolayers cultured in the SS condition, LC condition for 20 h, or 2, 4, and 6 h after a CS. Left panel, representative images; right panel, cytoplasmic Pearson’s correlation coefficient. Statistical analysis was done with Kruskal-Wallis test followed by Dunn’s multiple comparison test; **** p < 0.0001; ns, nonsignificant. Bars 15 μm. (B) Fluorescence covariance i ndex (FCI = Log10 PCC at cell periphery/PCC at cytoplasm) was done to compare the frequency of colocalization of 14-3-3ζ with ZO-2 in the cell borders with the colocalization in the cytoplasm. SS, steady state condition. The values of FCI 2 and 4 h after the CS are different from the SS condition since a small but significant proportion of cells exhibited FCI > 0 indicating that in them the colocalization of 14-3-3ζ with ZO-2 was higher at the cell borders than at the cytoplasm. Statistical analysis done with Kruskal-Wallis test followed by Dunn’s multiple comparison test; SS ≠ CS (2 h) **** p < 0.0001; SS ≠ CS (4 h) **** p < 0.0001; SS vs. CS (6 h) nonsignificant.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Cell Culture, Immunofluorescence, Fluorescence
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: Activation of the CaSR/PKCε signaling pathway reduces the cytoplasmic colocalization of 14-3-3 and ZO-2. MDCK cells cultured in the LC condition were treated or not for 2 h with 100 μM Gd 3+ or 200 nM bryostatin. Monolayers were processed for immunofluorescence with mouse antibodies against 14-3-3σ and 14-3-3ζ and rabbit antibodies anti-ZO-2. Left panel, representative images. Bars, 20 μm. Right panel, cytoplasmic PCC was done analyzing 100 cells per condition derived from two independent experiments. Statistical analysis done with Kruskal-Wallis followed by Dunn’s multiple comparison test; **** p < 0.0001; * p < 0.01.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Activation Assay, Cell Culture, Immunofluorescence, Derivative Assay
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: The cellular content of ZO-2 diminishes after the CS due to lysosome-mediated degradation. (A) The amount of ZO-2, 14-3-3σ, and 14-3-3ζ diminishes with the CS. Cell lysates were obtained from monolayers cultured in the LC condition for 20 h or 2, 4, and 6 h after a CS. Top panels, representative Western blots; bottom panels, densitometric analysis. Statistical analysis done with One Way ANOVA followed by Dunnett’s multiple comparison test. ns, not significant; * p < 0.05; ** p < 0.01; *** p < 0.001. All the results in this figure correspond to at least three independent experiments. (B) The decay of ZO-2 triggered by the CS can be reversed with cloroquine but not with MG132. Cell lysates were obtained from monolayers cultured in the LC condition for 20 h and incubated or not for 5 additional h with 30 μM cycloheximide (CHX) or transferred to NC media (CS) for 5 h in the presence or absence of 30 μM cycloheximide (CHX) with or without 30 μM MG132 or 50 μM cloroquine. Top panel, representative Western blot; bottom panel, densitometric analysis. Statistical analysis done with one way ANOVA followed by Dunnett’s multiple comparison test; ns, not significant; *** p < 0.001; ** p < 0.01; * p < 0.05. (C) The 14-3-3σ and 14-3-3ζ are degraded in the proteosome and not in the lysosome during the CS. Cell lysates were obtained from monolayers cultured in the LC condition for 20 h or transferred to NC media (CS) for 6 h in the presence or absence of 30 μM MG132 or 50 μM cloroquine. Top panel, representative Western blot; bottom panel, densitometric analysis. Statistical analysis done with one way ANOVA followed by Dunnett’s multiple comparison test. ns, not significant; * p < 0.05; *** p < 0.001. (D) The decrease in ZO-2 content is mediated by receptor-mediated endocytosis. Cell lysates were obtained from monolayers cultured in the LC condition for 20 h or transferred to NC media (CS) for 4 h in the presence or absence of 0.45 M sucrose (Suc). Top panel, representative Western blot; bottom panel, densitometric analysis. Statistical analysis done with one way ANOVA followed by Dunnett’s multiple comparison test; ns, not significant; * p < 0.05. (E) The decay of ZO-2 present after the CS is due to dynamin-dependent endocytosis. Cell lysates were obtained from monolayers cultured in the LC condition for 20 h or subjected to a CS for 4 h in the presence or absence of 80 μM dynasore. Top panel, representative Western blot; bottom panel, densitometric analysis. Statistical analysis done with one way ANOVA followed by Dunnett’s multiple comparison test; ns, not significant; * p < 0.05.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Cell Culture, Western Blot, Incubation
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 is endocyted and reaches late endosomes during the CS. Monolayers incubated in the LC condition or transferred to NC media for different periods of time were processed for immunofluorescence with antibodies against ZO-2, the early endosomal marker EEA-1 and the late endosomal marker Rab7. Representative images are from three independent experiments.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Incubation, Immunofluorescence, Marker
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: The U2 segment of ZO-2 favors the interaction of ZO-2 with 14-3-3. MDCK monolayers cultured in LC medium were transfected with WT hZO-2 (Flag-hZO-2) or a hZO-2 lacking the U2 region (Flag-hZO-2 ΔU2) and treated with 30 μM MG132 for 4 h. (A) A PLA assay was done employing a rabbit antibody against Flag and mouse antibodies against 14-3-3σ or 14-3-3ζ. Transfected cells were identified by their green staining after treatment with an antibody against rabbit coupled to Alexa Fluor 488. Background, untransfected cells. Bars, 15 μm. Top panel, representative images; bottom panel, quantitative analysis was done using BlobFinder. Statistical analysis done with one-way ANOVA followed by Dunnett’s multiple comparison test; *** p < 0.001; **** p < 0.0001. Results were obtained analyzing 20 transfected cells per condition derived from two independent experiments. (B) Immunoprecipitation assay was done with an antibody against Flag and blotted with antibodies against Flag, 14-3-3σ, and 14-3-3ζ. PIS, preimmune serum. Left panels, representative images; right panels, quantitative analysis of three independent experiments. Statistical analysis done with student’s t test; * p < 0.05; ** p < 0.01.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Cell Culture, Transfection, Staining, Derivative Assay, Immunoprecipitation
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: ZO-2 colocalizes with 14-3-3 in the nucleus, and residue S261 of cZO-2 is crucial for the nuclear importation the protein. (A) Left panel, percentage of cells with nuclear HA-ZO-2 as a function of time after transfection, determined by immunofluorescence using an anti HA antibody. Monolayers cultured in NC media were fixed at the indicated times. Time 0 corresponds to 6 h after transfection. Experiments were done with cells transfected with HA-cZO-2 WT, HA-cZO-2 S261A, and HA-cZO-2 T248A. Results are from three independent experiments. In each experiment, 100 transfected cells were evaluated per experimental point. Statistical analysis done with two way ANOVA followed by Bonferroni’s multiple comparison test. cZO-2 S261A and HA-cZO-2 T248A were compared against HA-cZO-2 WT; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. (B) Western blot against HA-ZO-2 present in nuclear, cytoplasmic, and plasma membrane fractions of cells at times 0 and 24 h of transfection with HA-cZO-2 WT and HA-cZO-2 S261A. Antibodies against lamin B1, Na + ,K + -ATPase β1 subunit, and GAPDH were employed as markers of nuclear, plasma membrane, and cytoplasmic fractions, respectively. Right panel, overexposed Western blot. (C) The reduced cellular content of HA-cZO-2 mutants T248A and S261A in comparison to WT HA-cZO-2 in LC cultured cells, recovers after proteasome inhibition with MG132. Western blot of cellular lysates derived from monolayers transfected with WT HA-cZO-2 or the mutants T248A and S261A in the presence or absence of 30 μM MG132. Statistical analysis was done with one-way ANOVA followed by Dunnett’s multiple comparisons test, * p < 0.05; ** p < 0.01. Results were obtained from three independent experiments. (D) cZO-2-HA colocalized with 14-3-3 σ and ζ in the nucleus at time 0 (6 h after transfection) and this interaction diminished 24 h later. Monolayers were transfected with HA-cZO-2 WT. Immunofluorescence done with antibodies against 14-3-3σ or 14-3-3ζ and anti HA. Top panel, representative images; bottom panel, PCC in the nucleus. Bars, 20 μm. Statistical analysis was done with two-tailed Student’s t test, **** p < 0.0001. Results were obtained from 20 transfected cells per experimental condition from to independent experiments.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Transfection, Immunofluorescence, Cell Culture, Western Blot, Inhibition, Derivative Assay, Two Tailed Test
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: cZO-2 mutants S261A and T248A displays reduced binding to 14-3-3σ and 14-3-3ζ. (A) The interaction of endogenous 14-3-3σ and transfected HA-cZO-2 diminishes with cZO-2 mutants S261A and T248A. Cells were transfected with WT HA-cZO-2 or the HA-cZO-2 mutants T248A and S261A. PLA was done with a rabbit antibody against HA and a mouse antibody against 14-3-3σ in the presence of MG132. In this experiment, the cells transfected with HA-cZO-2 or the HA-cZO-2 mutants T248A and S261A were identified with a rabbit antibody against HA, followed by a secondary anti rabbit antibody coupled to Alexa Fluor 488. Background corresponds to cells not transfected with HA-cZO-2. Bars, 15 μm. Left panel, representative images; right panel, quantitative analysis done using BlobFinder. Statistical analysis was done with Kruskal-Wallis test followed by Dunn’s multiple comparison test; * p < 0.05; **** p < 0.0001. Results were obtained with 30 transfected cells per condition derived from two independent experiments. (B) The interaction of endogenous 14-3-3ζ with transfected HA-cZO-2 diminished in mutants cZO-2 S261A and T248A. Cells were transfected with HA-cZO-2 or the HA-cZO-2 mutants T248A and S261A. PLA were done in the presence of MG132 with a rabbit antibody against HA and a mouse antibody against 14-3-3ζ. In this experiment, the transfected cells were identified with a rabbit antibody against HA, followed by a secondary anti rabbit antibody coupled to Alexa Fluor 488. Background corresponds to cells not transfected with HA-cZO-2. Bars, 20 μm. Results were obtained from 30 transfected cells per condition derived from two independent experiments. Left panel, representative images; right panel quantitative analysis done using BlobFinder. Statistical analysis done with Kruskal-Wallis test followed by Dunn’s multiple comparison test; * p < 0.05; *** p < 0.001; **** p < 0.0001. (C) The interaction between cZO-2 and 14-3-3σ or 14-3-3ζ diminishes in the mutant HA-cZO-2 S261A but not in the mutant HA-cZO-2 T248A. Cells cultured in LC condition were transfected with WT HA-cZO-2 or the HA-cZO-2 mutants T248A and S261A. ZO-2 was immunoprecipitated with a mouse antibody against HA and blotted with a mouse antibody against 14-3-3σ or a rabbit antibody against 14-3-3ζ. Left panel, representative image of 14-3-3σ blot; right panel, representative image of 14-3-3ζ blot. Bottom panels, quantitative analysis done with one-way ANOVA; * p < 0.05.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Binding Assay, Transfection, Derivative Assay, Mutagenesis, Cell Culture, Immunoprecipitation
Journal: Molecular Biology of the Cell
Article Title: Activation of the Ca 2+ sensing receptor and the PKC/WNK4 downstream signaling cascade induces incorporation of ZO-2 to tight junctions and its separation from 14-3-3
doi: 10.1091/mbc.E18-09-0591
Figure Lengend Snippet: Schematic representation of the signaling cascade activated by the CaSR that induces the arrival of ZO-2 to TJs. The presence of calcium in the extracellular media or of Gd 3+ activates the CaSR present in the plasma membrane, which subsequently activates the Gα q/11 subunit that turns on a signaling cascade that leads to the activation of nPKCε. This kinase phosphorylates WNK4, which in turn phosphorylates ZO-2 triggering its disassembly from 14-3-3 and relocation to TJs. Residue S261 of ZO-2, located within a NLS, binds to 14-3-3σ and ζ and facilitates the importation of ZO-2 into the nucleus. Red lines, signaling pathway that leads to ZO-2 recruitment to the cell borders; blue lines, effect of drugs used in this study.
Article Snippet: In this experiment, cells transfected with HA-ZO-2 were identified with the latter mouse antibody anti HA, followed by a secondary goat anti-mouse IgG coupled to Alexa Fluor 488 (Cat. A11001, dilution 1:500, Life Technologies, Carlsbad, CA) ( ); 3) a
Techniques: Activation Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative images of DNA, YAP, and ZO-2 at the lateral plane in MDCK cells under different cell-density conditions. Scale bar, 25 µm. (B) Representative images of ZO-2 depleted cells at confluent cell density 72 hours after seeding. Distributions of DNA, E-cadherin, YAP, and ZO-1 are shown as X-Y views (ZO-1 is at the apical plane, and all others at the lateral plane), and those of YAP, DNA, and gp135 are shown as cross-sectional views. Scale bar, 25 µm. (C) Representative immunoblotting images for ZO-2 and GAPDH from extracts of ZO-2 depleted cells. (D) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm in cells shown in (B). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 20 cells for each condition. p -values; student’s t-test. (E) Representative immunoblotting images for ZO-2, LATS1, S909-phosphorylated LATS1 (pLATS S909), YAP, S127-phosphorylated YAP (pYAP S127), MST1, T183/T180-phosphorylated MST1/2 (pMST1 T183 / pMST2 T180), GAPDH, histone H3 (H3), and S10-phosphorylated histone H3 (pH3 S10) from extracts of control cells and ZO-2 depleted cells at different cell densities.
Article Snippet:
Techniques: Western Blot, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: Representative images of MDCK cells and those depleted of ZO-2 at the low cell density. The distributions of DNA and YAP are shown as X-Y views. Scale bar, 10 µm.
Article Snippet:
Techniques:
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) ZO-2 is required to maintain the levels of LATS1 protein at high cell density. (A) Representative immunoblotting images for ZO-2, endogenous LATS1 (longer exposure: LE, shorter exposure: SE), S909-phosphorylated LATS1 (pLATS S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control and ZO-2 depleted cells. (B) FLAG-LATS1 and HA-ZO-2 immunoblotting images from control and ZO-2 depleted cells with or without ZO-2 transgene are shown. (C) Lats1 mRNA abundance is unaffected by ZO-2 knockdown. The graph depicts the levels of Lats1 mRNA (normalized to those of Gapdh mRNA) measured by RT-qPCR. Plots represent mean values ± s.d. from three independent experiments. p -values; Mann-Whitney test. (D) ZO-2 limits poly-ubiquitination of LATS1 in cells at high density. Representative immunoblotting images for poly-ubiquitin moiety, FLAG-LATS-1, HA-ZO-2, and GAPDH from the FLAG-LATS1 immuno-precipitates are shown. FLAG-LATS1 were immune-precipitated from extracts of control and ZO-2 depleted cells with or without ZO-2 transgene. (E) Inhibition of poly-ubiquitination increases the LATS1 protein level in ZO-2-depleted cells. Representative immunoblotting images for ZO-2, LATS1, S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control cells, and ZO-2 depleted cells with or without the expression of HA-ubiquitin K0 are shown. (F) Inhibition of proteasome activity increases the LATS1 protein level in ZO-2 depleted cells. Representative immunoblotting images for ZO-2, LATS1, and S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control cells, and ZO-2 depleted cells with or without MG132 treatment are shown. (G) A model of proteasome-mediated degradation of LATS1. ZO-2 antagonizes with poly-ubiquitination and degradation of LATS1. (H) Increased levels in LATS1 protein is insufficient for the restoration of nuclear-to-cytoplasm translocation of YAP in ZO-2 depleted cells. Left: representative images of cells depleted of ZO-2 with or without MG132 treatment. Right: representative images of ZO-2 depleted cells with FLAG-ZO-2 transgene after MG132 treatment. The distributions of YAP were visualized 72 hours after seeding. Scale bar, 25 µm. (I) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm from cells shown in (F). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 71, 37, 62 cells for each condition. p -values; student’s t-test.
Article Snippet:
Techniques: Western Blot, Quantitative RT-PCR, MANN-WHITNEY, Inhibition, Expressing, Activity Assay, Translocation Assay, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Diagrammatic representation of HA-tagged ZO-2 fragments used in (B). (B) Representative images of MDCK cells expressing full-length HA-ZO-2 or HA-ZO-2[1-590 aa]. Distributions of DNA, HA-ZO-2 fusions, and YAP are shown as X-Y views. The area of nuclei in cells expressing HA-tagged ZO2 are marked by white dotted lines. Scale bar, 25 µm.
Article Snippet:
Techniques: Expressing
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) Representative immunoblotting images for (A) ZO-2 and LATS1, (B) ZO-2 and YAP in the ZO-2 immunoprecipitates. ZO-2 was immunoprecipitated from extracts of cells at different cell-density conditions. Levels of ZO-2, LATS1, YAP, and GAPDH in cell extracts are shown as inputs. (C) ZO-2 stimulates an interaction between LATS1 and YAP at high cell density. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates are shown. FLAG-YAP was immunoprecipitated from extracts of control cells and ZO-2 depleted cells at high density. Levels of ZO-2 and LATS1 in cell extracts are shown as inputs. (D) Diagrammatic representation of HA-tagged ZO-2 fragments used in (E) and (F). (E) ZO-2 associates with LATS1 via the SH3 domain. Representative immunoblotting images for HA-tagged ZO-2 fragments and FLAG-LATS1 in the FLAG-LATS1 immuno-precipitates are shown. FLAG-LATS1 was immunoprecipitated from the extracts of cells expressing various ZO-2 fragments. Levels of HA-ZO-2 fragments and GAPDH in cell extracts are shown as inputs. (F) The interaction between LATS1 and YAP requires the SH3 domain of ZO-2. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates. FLAG-YAP was immunoprecipitated from extracts of ZO-2 depleted cells expressing HA-EV, HA-ZO-2, or HA-ZO-2(ΔSH3). Levels of HA-ZO-2, HA-ZO-2(ΔSH3), LATS1, FLAG-YAP, and GAPDH in cell extracts are shown as inputs. (G and H) LATS1 interacts with ZO-2 through its SH3 domain-binding motifs. Representative immunoblotting images for HA-ZO-2, FLAG-LATS1, and GAPDH in FLAG-LATS1 immunoprecipitates are shown. FLAG-LATS1 fusions were immunoprecipitated from extracts of cells at high density. The levels of HA-ZO-2, FLAG-LATS1, and GAPDH in cell extracts are shown as inputs. (I) ZO-2 acts as a scaffold that associates with both LATS1 and YAP. Representative immunoblotting images for HA-LATS1, HA-ZO-2, and FLAG-YAP in the FLAG-YAP immunoprecipitates. FLAG-YAP was immunoprecipitated from extracts of cells expressing various levels of ZO-2. Levels of HA-ZO-2 and HA-LATS1 in cell extracts are shown as inputs. (J) Diagrammatic representation of the formation of a tripartite complex comprising LATS1–ZO-2–YAP.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Expressing, Binding Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) ZO-2 recruits S909-phosphorylated LATS1 to the apical junctions. Representative distributions of S909-phosphorylated LATS1 (pLATS1 S909) in control cells and ZO-2 depleted cells (A) and ZO-2 depleted cells with FLAG-ZO-2 transgene (B). Scale bar, 25 µm. (C) ZO-2 associates with S909-phosphorylated LATS1. Representative immunoblotting images for S909-phosphorylated LATS1 (pLATS1 S909) and ZO-2 in the ZO-2 immunoprecipitates. ZO-2 was immunoprecipitated from extracts of cells at high density. Levels of pLATS1 S909, ZO-2, and GAPDH in cell extracts are shown as inputs. (D) Representative immunoblotting images for ZO-1, ZO-2, and GAPDH in control cells and ZO-1 depleted cells. (E) ZO-1-dependent tight junctions are essential for the recruitment of ZO-2 and S909-phosphorylated LATS1 to the apical junctions. Representative distributions of ZO-2 and S909-phosphorylated LATS1 (pLATS1 S909) in control cells and ZO-1 depleted cells. Scale bar, 25 µm. (F) ZO-1-dependent tight junction is essential for efficient phosphorylation of LATS1 and YAP. Representative immunoblotting images for ZO-1, LATS1, S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), MST1, T183/T180-phosphorylated MST1/2 (pMST1 T183 / pMST2 T180), and GADPH in extracts of control cells and ZO-1 depleted cells are shown. (G) ZO-1-dependent tight junctions are required for effective translocation of YAP from the nucleus to the cytoplasm. Representative distributions of DNA, YAP, and ZO-2 in control cells and ZO-1 depleted cells at high density are shown as X-Y views (top) and cross-sectional views (bottom). Scale bar, 25 µm. (H and I) Quantification of the ratio of YAP intensities (H) and ZO-2 intensities (I) in the nucleus relative to that in the cytoplasm from cells shown in (G). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 20 cells (H) and n = 30 cells (I) for each condition. p -values; student’s t-test.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Translocation Assay, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) ZO-1 is dispensable for the formation of LATS1–ZO-2–YAP tripartite complex. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates are shown. FLAG-YAP was immunoprecipitated from extracts of control cells and ZO-1 depleted cells at high density. Levels of ZO-1, LATS1, FLAG-YAP, and GAPDH in cell extracts are shown as inputs. (B-D) Recruitment of tight-junctional proteins, Amot or NF2, to the LATS1-ZO-2-YAP tripartite complex induces efficient phosphorylation of LATS1 and YAP. (B) Diagrammatic representation of artificial recruitment of Amot and NF2 to ZO-2. (C and D) Recruitment of Amot and NF2 to the LATS1-ZO-2-YAP tripartite complex induces efficient nuclear exit of YAP. (C) Representative images of YAP distribution in ZO-1 depleted cells expressing YFP-FRB and CFP-FKBP after AP21967 treatment and in those expressing YFP-ZO-2-FRB and either CFP-FKBP-Amot or CFP-FKBP-NF2 before and after AP21967 treatment are shown. Scale bar, 25 µm. (D) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm from cells shown in (C). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 25, 18, 22, 15, 9, 12 cells for each condition. p -values; Mann-Whitney test.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Expressing, Whisker Assay, MANN-WHITNEY
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative immunoblotting images for FLAG-ZO-1, HA-ZO-2, HA-MST-1/2, HA-LATS1, and HA-YAP in FLAG-ZO-1 immunoprecipitates. FLAG-ZO-1 was immunoprecipitated from extracts of cells at high density. Levels of FLAG-ZO-1, HA-ZO-2, HA-MST-1/2, HA-LATS1, HA-YAP, and GAPDH from cell extracts are shown as inputs. (B) Representative immunoblotting images for FLAG-MST1, FLAG-YAP, and HA-LATS1 in FLAG immunoprecipitates. FLAG fusions were immunoprecipitated from extracts of cells at high density. Levels of FLAG-MST1, FLAG-YAP, HA-LATS1, and GAPDH from cell extracts are shown as inputs.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative immunoblotting images for LATS1, S909-phosphoryalted LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of ZO-1-depleted cells expressing CFP-FKBP-Amot, CFP-FKBP, YFP-ZO-2-FRB, and YFP-FRB before and after AP21967 treatment are shown. (B) Representative immunoblotting images for LATS1, S909-phosphoryalted LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of ZO-1-depleted cells expressing CFP-FKBP-NF2, CFP-FKBP, YFP-ZO-2-FRB and YFP-FRB before and after AP21967 treatment are shown.
Article Snippet:
Techniques: Western Blot, Expressing